Idine (BrdU; 50 mg/g body weight) was administered for incorporation into newly synthesized DNA. At 2 hr after BrdU injection, pups were perfused transcardially with 4 paraformaldehyde in PBS under deep anesthesia. Brains were further fixed in the same fixative over night at 4uC, and then immersed in PBS containing 20 sucrose. Sagittal sections on glass slides were treated with 2N HCl for 30 min. Following incubation with blocking buffer, the sections were incubated overnight with a mouse anti-BrdU antibody (1:1000; Pharmingen, San Diego, CA) at 4uC, washed with PBS, and incubated for 1 hr with anti-mouse IgG conjugated to rhodamine.In Situ HybridizationDigoxigenin-labeled antisense/sense probes were used for in situ hybridization as previously described [29]. A fragment of mouse CD44 cDNA was obtained by PCR
using the primers 59CGGAATTCCCGCTACGCAGGTGTATTCC -39 and 59GCTCTAGATAATGGCGTAGGGCACTACAC -39 (Genbank accession number, NM_009851) [30] and subcloned into the EcoRI and XbaI sites of pBluescriptSKII(+). After linearizing the plasmid (antisense: EcoRI, sense: XbaI), digoxigenin-labeled antisense/sense probes were synthesized by RNA polymerase (antisense: T3 RNA polymerase, sense: T7 RNA polymerase). mRNA in cryosectioned tissue (14 mm thickness) was detected with alkaline phosphatase conjugated anti-digoxigenin antibody (Roche) and nitroblue tetrazolium/5-bromo-4-chloro-39-indolyl phosphate.Statistical AnalysisResults are presented as the mean 6 SEM. Student’s t-test was used to determine the significance of differences between groups.ResultsPreviously, we have identified GNF-7 chemical information cerebellar astrocyte precursor cells. CD44high cells isolated from 16574785 glial-enriched cellular fraction of P3 mouse cerebellum by FACS were positive for astrocyte-lineage markers (BLBP, GLAST) and the neural stem cell marker (nestin) but were negative for the mature astrocyte marker (GFAP), the immature oligodendrocyte marker (O4) or the neuronal marker (Tuj1). We concluded that these CD44high cells were astrocyte precursor cells because they produced no neurospheres, and gave rise only to astrocytes in the absence of any signaling molecule in vitro. [9]. However, we have not characterized CD44low cells. To examine whether only CD44high cells are astrocyte precursor cells or not, we compared the ability of neurosphere formation and the 374913-63-0 site expression of cell-type specific markers between CD44high cells and CD44low cells. CD44high cells and CD44low cells were collected from glial-enriched cellular fraction of P3 mouse cerebellum by the same methods with previous report (Fig. 1A) [9]. Both of CD44high cells and CD44low cells yielded neurospheres under FGF-2 and heparin (Fig. 1531364 1B). In our previous report, CD44high cells had been cultured with only FGF-2 (not with heparin), therefore CD44high cells might fail to form neurospheres [9]. Most of CD44low cells expressed nestin, Sox2, GLAST and BLBP as same as CD44high cells (Fig. 1C and 1D). On the otherhand, GFAP, O4, and Tuj1 were less expressed in both CD44high cells and CD44low cells (Fig. 1C and 1D, data not shown). This result suggests that CD44high cells do not have a specific character as astrocyte precursors among total CD44-positive cells. The result of neurosphere assay suggested that CD44-positive cells of P3 cerebellum certainly contain neural stem cells. This means we need more careful analysis to determine whether CD44 expression is restricted only to astrocyte-lineage cells or not. Here, we focused on the expressi.Idine (BrdU; 50 mg/g body weight) was administered for incorporation into newly synthesized DNA. At 2 hr after BrdU injection, pups were perfused transcardially with 4 paraformaldehyde in PBS under deep anesthesia. Brains were further fixed in the same fixative over night at 4uC, and then immersed in PBS containing 20 sucrose. Sagittal sections on glass slides were treated with 2N HCl for 30 min. Following incubation with blocking buffer, the sections were incubated overnight with a mouse anti-BrdU antibody (1:1000; Pharmingen, San Diego, CA) at 4uC, washed with PBS, and incubated for 1 hr with anti-mouse IgG conjugated to rhodamine.In Situ HybridizationDigoxigenin-labeled antisense/sense probes were used for in situ hybridization as previously described [29]. A fragment of mouse CD44 cDNA was obtained by PCR using the primers 59CGGAATTCCCGCTACGCAGGTGTATTCC -39 and 59GCTCTAGATAATGGCGTAGGGCACTACAC -39 (Genbank accession number, NM_009851) [30] and subcloned into
the EcoRI and XbaI sites of pBluescriptSKII(+). After linearizing the plasmid (antisense: EcoRI, sense: XbaI), digoxigenin-labeled antisense/sense probes were synthesized by RNA polymerase (antisense: T3 RNA polymerase, sense: T7 RNA polymerase). mRNA in cryosectioned tissue (14 mm thickness) was detected with alkaline phosphatase conjugated anti-digoxigenin antibody (Roche) and nitroblue tetrazolium/5-bromo-4-chloro-39-indolyl phosphate.Statistical AnalysisResults are presented as the mean 6 SEM. Student’s t-test was used to determine the significance of differences between groups.ResultsPreviously, we have identified cerebellar astrocyte precursor cells. CD44high cells isolated from 16574785 glial-enriched cellular fraction of P3 mouse cerebellum by FACS were positive for astrocyte-lineage markers (BLBP, GLAST) and the neural stem cell marker (nestin) but were negative for the mature astrocyte marker (GFAP), the immature oligodendrocyte marker (O4) or the neuronal marker (Tuj1). We concluded that these CD44high cells were astrocyte precursor cells because they produced no neurospheres, and gave rise only to astrocytes in the absence of any signaling molecule in vitro. [9]. However, we have not characterized CD44low cells. To examine whether only CD44high cells are astrocyte precursor cells or not, we compared the ability of neurosphere formation and the expression of cell-type specific markers between CD44high cells and CD44low cells. CD44high cells and CD44low cells were collected from glial-enriched cellular fraction of P3 mouse cerebellum by the same methods with previous report (Fig. 1A) [9]. Both of CD44high cells and CD44low cells yielded neurospheres under FGF-2 and heparin (Fig. 1531364 1B). In our previous report, CD44high cells had been cultured with only FGF-2 (not with heparin), therefore CD44high cells might fail to form neurospheres [9]. Most of CD44low cells expressed nestin, Sox2, GLAST and BLBP as same as CD44high cells (Fig. 1C and 1D). On the otherhand, GFAP, O4, and Tuj1 were less expressed in both CD44high cells and CD44low cells (Fig. 1C and 1D, data not shown). This result suggests that CD44high cells do not have a specific character as astrocyte precursors among total CD44-positive cells. The result of neurosphere assay suggested that CD44-positive cells of P3 cerebellum certainly contain neural stem cells. This means we need more careful analysis to determine whether CD44 expression is restricted only to astrocyte-lineage cells or not. Here, we focused on the expressi.