Lycytidylic acid potassium salt (Poly IC); (iii) TLR4: 1 mg/ml Lipopolysaccharide from E. coli, Serotype R515; (iv) TLR5: 100 ng/ml Flagellin (FLIC); (v) TLR6: 100 ng/ml Macrophage stimulatory Lipopeptide 2 (MALP-2); (vi) TLR7?: 10 mg/ml Polyuridylic acid potassium salt and (vii) TLR9: 2 mg/ml CpG ODN 2395. Mouse monocytes were obtained from the spleens of TLR9 wild-type and null mice (C57BL/6BJ6 background) following a previous described protocol [19]. After isolation primary murine monocytes were cultured in RPM-I and stimulated 18 hours with 2 mg/ml CpG ODN 2395.BIOTECH. Human (h) and murine (m) sense and antisense primers were as following: hFXR: tacatgcgaagaaagtgtcaaga and actgtcttcattcacggtctgat; hTNFa: aacctcctctctgccatcaa and ggaagacccctcccagatag; hGAPDH: gaaggtgaaggtcggagt and catgggtggaatcatattggaa; mFXR:; mTNFa: acggcatggatctcaaagac and gtgggtgaggagcacgtagt; mIRF7: agccctctgctttctagtgatg and ctgcatagggttcctcgtaaac; mGAPDH: ctgagtatgtcgtggagtctac and gttggtggtgcaggatgcattg.FXR promoter analysis, plasmid construction and Luciferase assayHuman and murine proximal promoter regions of FXR were analyzed with the on-line software TFsearch (http://www.cbrc.jp/ research/db/TFSEARCH.html) for the search of putative IRF7 consensus sequences (GAA (A/T) N (C/T) GAAAN (T/C)). For luciferase assay, three tandem repeats of the putative IRF7 responsive sequence (IRF7RE) were cloned KpnI-XhoI into the pGL4 luciferase reporter vector (pGL3(IRF7RE)3X) using the following oligonucleotides: ACTGGGTACCCCTGAATATCAAAGCTGCCCTGAATATCAAAGCTGCCCTGAATATCAAAGCTGCCTCGAGACTG and CAGTCTCGAGGCAGCTTTGATATTCAGGGCAGCTTTGATATTCAGGGCAGCTTTGATATTCAGGGGTACCCAGT. 24 h before transfection, 106105 Raw264.7 cells were plated in six-well plates and cultured in D-MEM. Subsequently, cells were 18055761 transiently transfected using 1 mg pGL4(IRF7RE)3X and 200 ng pCMVbgalactosidase as an internal control for transfection efficiency. Transfections were performed with the reagent FuGENE HD (Promega). Forty-eight hours post-transfection, cells were stimulated
18 hours with a dose response of CpG ODN 2395 (0.5, 1, 2 and 4 mg/ml). Control cultures received vehicle (0.1 DMSO) alone. Cells were lysed in 100 mL diluted reporter lysis buffer (Promega), and 10 mL of cellular lysate was assayed for luciferase activity using the Glomax 20/20 luminometer (Promega, Milan, Italy). Luciferase activities were normalized for transfectionRNA extraction and nuclear receptor PCR arrayTotal RNA from serum starved Raw264.7 cells left untreated or stimulated with CpG ODN 2395 (2 mg/ml) was extracted with Trizol reagent (Invitrogen) and reverse transcribed with Superscript-II reverse transcriptase (Invitrogen) following the manual instructions. 25 ng cDNA was pipetted in each well of a 96 well PCR array plate (Human Nuclear Receptors and Coregulators RT2 Profiler TM PCR Array – http://www.sabiosciences.com/ rt_pcr_product/HTML/PAHS-056A.html – Superarray Bioscience, MedChemExpress Nobiletin Frederick,MD, USA) and amplified following the manual instructions. Genes selected for PCR analysis encode several classes of nuclear receptors. PCR analysis was carried out with the on-line software RT2 Profiler PCR Array Data Analysis (http:// pcrdataanalysis.sabiosciences.com/pcr/arrayanalysis.php).Real-Time PCRMethods for Real-Time PCR conditions and analysis have been described previously [34].
Primers were synthesized by MWGFXR Is a Novel TLR-9 Target Geneefficiencies by 79983-71-4 site dividing the relative light units (RLU) by bgalactosidase activity.St.Lycytidylic acid potassium salt (Poly IC); (iii) TLR4: 1 mg/ml Lipopolysaccharide from E. coli, Serotype R515; (iv) TLR5: 100 ng/ml Flagellin (FLIC); (v) TLR6: 100 ng/ml Macrophage stimulatory Lipopeptide 2 (MALP-2); (vi) TLR7?: 10 mg/ml Polyuridylic acid potassium salt and (vii) TLR9: 2 mg/ml CpG ODN 2395. Mouse monocytes were obtained from the spleens of TLR9 wild-type and null mice (C57BL/6BJ6 background) following a previous described protocol [19]. After isolation primary murine monocytes were cultured in RPM-I and stimulated 18 hours with 2 mg/ml CpG ODN 2395.BIOTECH. Human (h) and murine (m) sense and antisense primers were as following: hFXR: tacatgcgaagaaagtgtcaaga and actgtcttcattcacggtctgat; hTNFa: aacctcctctctgccatcaa and ggaagacccctcccagatag; hGAPDH: gaaggtgaaggtcggagt and catgggtggaatcatattggaa; mFXR:; mTNFa: acggcatggatctcaaagac and gtgggtgaggagcacgtagt; mIRF7: agccctctgctttctagtgatg and ctgcatagggttcctcgtaaac; mGAPDH: ctgagtatgtcgtggagtctac and gttggtggtgcaggatgcattg.FXR promoter analysis, plasmid construction and Luciferase assayHuman and murine proximal promoter regions of FXR were analyzed with the on-line software TFsearch (http://www.cbrc.jp/ research/db/TFSEARCH.html) for the search of putative IRF7 consensus sequences (GAA (A/T) N (C/T) GAAAN (T/C)). For luciferase assay, three tandem repeats of the putative IRF7 responsive sequence (IRF7RE) were cloned KpnI-XhoI into the pGL4 luciferase reporter vector (pGL3(IRF7RE)3X) using the following oligonucleotides: ACTGGGTACCCCTGAATATCAAAGCTGCCCTGAATATCAAAGCTGCCCTGAATATCAAAGCTGCCTCGAGACTG and CAGTCTCGAGGCAGCTTTGATATTCAGGGCAGCTTTGATATTCAGGGCAGCTTTGATATTCAGGGGTACCCAGT. 24 h before transfection, 106105 Raw264.7 cells were plated in six-well plates and cultured in D-MEM. Subsequently, cells were 18055761 transiently transfected using 1 mg pGL4(IRF7RE)3X and 200 ng pCMVbgalactosidase as an internal control for transfection efficiency. Transfections were performed with the reagent FuGENE HD (Promega). Forty-eight hours post-transfection, cells were stimulated 18 hours with a dose response of CpG ODN 2395 (0.5, 1, 2 and 4 mg/ml). Control cultures received vehicle (0.1 DMSO) alone. Cells were lysed in 100 mL diluted reporter lysis buffer (Promega), and 10 mL of cellular lysate was assayed for luciferase activity using the Glomax 20/20 luminometer (Promega, Milan, Italy). Luciferase activities were normalized for transfectionRNA extraction and nuclear receptor PCR arrayTotal RNA from serum starved Raw264.7 cells left untreated or stimulated with CpG ODN 2395 (2 mg/ml) was extracted with Trizol reagent (Invitrogen) and reverse transcribed with Superscript-II reverse transcriptase (Invitrogen) following the manual instructions. 25 ng cDNA was pipetted in each well of a 96 well PCR array plate (Human Nuclear Receptors and Coregulators RT2 Profiler TM PCR Array – http://www.sabiosciences.com/ rt_pcr_product/HTML/PAHS-056A.html – Superarray Bioscience, Frederick,MD, USA) and amplified following the manual instructions. Genes selected for PCR analysis encode several classes of nuclear receptors. PCR analysis was carried out with the on-line software RT2 Profiler PCR Array Data Analysis (http:// pcrdataanalysis.sabiosciences.com/pcr/arrayanalysis.php).Real-Time PCRMethods for Real-Time PCR conditions and analysis have been described previously [34]. Primers were synthesized by MWGFXR Is a Novel TLR-9 Target Geneefficiencies by dividing the relative light units (RLU) by bgalactosidase activity.St.